Ntbbf1arrolb

Author: rfql

August undefined, 2024

Web9 okt. 2014 · -2801 ggctggtttctaagacattttttggtttaatccaaacctaattacaa atatt cccaacaa rootmotiftapox1 -2741 gatcgaatgatctatggctacaaaccctatcccaacaaaaaactacatttagtacatcaa -2681 ... WebAnalysis of signal sequence motifs in the promoter regions of the Arabidopsis class 1 and class 2 Pgbs

Untitled – Word cloud – WordItOut

Web21 sep. 2024 · Background Transgenic technology has become an important technique for crop genetic improvement. The application of well-characterized promoters is essential for developing a vector system for efficient genetic transformation. Therefore, isolation and functional validation of more alternative constitutive promoters to the CaMV35S … WebGenerate, customise, save, share, gift, print, browse & love word cloud art with WordItOut, the free word cloud maker online since 2010. personalplanung software

Identification and characterization of the - ScienceDirect

Web1 jun. 2010 · A prerequisite for biotechnological improvements of storage roots is the availability of tissue-specific promoters enabling high expression of transgenes. In this work, we cloned two genomic fragments, pMe1 and pDJ3S , controlling the expression of a gene with unknown function from cassava ( Manihot esculenta ) and of the storage protein … Web30 jan. 2024 · As a control, free GFP (pTF486) was transiently expressed in tomato protoplasts. Fluorescence was examined with a confocal laser scanning microscope … personal play identity

Frontiers Genome-Wide Small RNA Analysis of Soybean Reveals …

Cloning and characterization of a novel - ScienceDirect

Web1 jun. 2009 · We describe the development of a reporter system for monitoring meristem initiation in poplar using promoters of poplar homologs to the meristem-active regulatory genes WUSCHEL ( WUS ) and SHOOTMERISTEMLESS ( STM ). When ~3 kb of the 5′ flanking regions of close homologs were used to drive expression of the GUSPlus gene, … Web9 nov. 2024 · Main conclusion Several cis-elements including Myb-binding motifs together confer glandular trichome specificity as revealed from heterologous expression and … personal playgroundWeb1 feb. 2016 · Diversity analysis of maize GH3 genes The GH3 gene family is widely distributed in plant king- dom. GH3 genes have been identified and characterized in … standing wheelchairs for sale

"Web22 nov. 2012 · Abstract. Table S1. Identification of hormone-responsive cis-acting elements within the 5’-region of barley genes potentiated by Pseudomonas fluorescens (strain … " - Ntbbf1arrolb

Ntbbf1arrolb

Distribution of ARR1AT motifs in Arabidopsis WUS and STM

WebA functional analysis of miR399, a salt-responsive miRNA in the root meristem, indicates the crucial role of this miRNA in modulating soybean root developmental plasticity. Our … WebIn the promoter of the WUS gene of Arabidopsis and its two orthologs in Populus trichocarpa (PopWUS1 and PopWUS2) various auxin sensitive elements were detected: AuxRE, …

Did you know?

Web4 mei 2015 · Notably, seven auxin-responsive cis-elements (NTBBF1ARROLB and AUXREPSIAA4)/auxin response factor-binding sites (ARFAT) and 11 nodulin consensus … Web16 feb. 2024 · Among the enriched CAREs, four (NTBBF1ARROLB, SORLIP5AT, ANAC_C3b and E2FCONSENSUS) were unique to a given subnetwork, and two (RVE1–2 and LECPLEACS2) were only co-enriched in the VviATL89 (VIT ...

Web28 mei 2024 · Twenty-two different kinds of cis elements having some developmental and hormonal-responsive roles were identified—ARR1AT: cytokinin-regulated transcription … Web12 mrt. 2012 · NTBBF1ARROLB: 10: Required for tissue-specific expression and auxin induction; Agrobacterium rhizogenes: SEBFCONSSTPR10A: 3: Similar to the auxin …

Web16 apr. 2015 · Furthermore, the SlARF9 promoter sequence contains several NTBBF1ARROLB-elements. These elements were first identified in the promoter sequence of rolB , one of the oncogenes present in the T-DNA sequence of Agrobacterium rhizogenes , and are involved in the auxin-inducible expression of the rolB -gene in plants ( … Web10 nov. 2024 · We chose to focus on three auxin response elements: the AuxRR-core (GGTCCAT), TGA-element (AACGAC), and ntBBF1ARROLB (named BBF) (ACTTTA), …

Web30 apr. 2024 · Four common cis-regulatory elements, CATATGGMSAUR, ASF1MOTIFCAMV, NTBBF1ARROLB and ARFAT, were found related to plant …

Webpssdr1 pscxe1 psat1 cyp82y1 cyp82x1 cyp82x2 cyp719a21 psmt3 psmt2 psmt1 s000042 iro2os cacgtgg s000505 prolaminboxosglub1 tgcaaag s000354 tgtcacacmcucumisin tgtcaca personal playlistWeb6 feb. 2024 · Sucrose is an important component of fruit flavor, but whether sucrose signaling affects the postharvest ripening process of kiwifruit is unclear. The aim of this … standing wireless phone chargerWeb1 mei 2014 · Among these elements, NTBBF1ARROLB motif (ACTTTA) is the binding site for NtBBF1 (Dof protein) and is required for auxin induction, gene expressions in … standing while eating buffetWeb2 okt. 2012 · ntbbf1arrolb site 177 (+) acttta s000273 OSE1ROOTNODULE site 659 (+) AAAGAT S000467 OSE2ROOTNODULE site 249 (+) CTCTT S000468 standing with arms foldedWeb14 jul. 2024 · Our analysis of osa-miR167 members also found that auxin-responsive CREs (ARFAT, ASF1MOTIFCAMV, CATATGGMSAUR, NTBBF1ARROLB and … standing with arms crossedWebShaded rows indicate that putative cis-regulatory elements were detected in all 3 promoters. cis Element Sequence Number of Elements GmActin GmRpS11 GmHsp90 1 2 0 Predicted Function -10 promoter element, light -10PEHVPSBD TATTCT regulation and circadian rhythms, chloroplast gene 2SSEEDPROTBANAPA CAAACAC 0 1 0 … standing wide angle forward foldWebThis review examines how phytoglobins (Pgbs), proteins associated with stress responses and able to modulate nitric oxide (NO) homeostasis, also control fundamental aspects of … standing with eyes closed test